Trash Heap

Ever wonder where New York City's garbage goes?

Caravaggio Warmup 1

For my warmups I'm going to copy a Caravaggio painting in Photoshop for 30 minutes. I want to see how much I can get done in that time span. It will be a fun experiment...

Rendered

I just made this monstrosity in Photoshop. I'm pretty ashamed of it. It's hideous. I was just messing around with value painting and then overlaying that painting with color. Just an experiment. But it made me realize something interesting. Today, products designed for mass appeal are all marketed with rendered mascots and fonts. Cheap toy packages, cereal boxes, movie posters. All of the artwork is rendered to look quasi 3D.

Flat 2D design is the realm of high end snob products with the exception of website and professional sports team logos.

I don't know maybe the lowest common denominator likes their imaginary spokespeople and product names realistically lit.

I personally get a headache trying to navigate the cereal aisle. Too many highlights and drop shadows give me a migraine.

French Fried Fish

Oh baby it's like honeybutter and toast on jam.

Control Those Urges, Kiddies...

So apparently a good indicator of becoming a successful adult is learning to delay gratification while you're still a child. According to the article children who can forego scarfing down sugary treats for a little while with the promise of getting more sugary treats later get higher SAT scores and are usually more financially well off as adults.

Hmmmm... that's very interesting... I should learn how to delay my gratification. I just have one question. How long will I have to wait before I cash out?

Yeah, I want to know how long I have to be a good-doobie before I can really live it up? What are we talking here? Two years? Five years?

Yeah, how long do I have to work a nine-to-five before I'm blowing lines off supermodels' thighs on a yacht off the coast of Nice?

Forever?! What's the point of controlling your urges then? Fuck it.... I'm calling out of work and I'm going to buy an eighth, and a case of Natural Ice, so I can get fucked up, watch Kung Fu movies, and shoot my potato gun at the 'Slow, Children At Play' sign across the street. Fuck this delaying gratification bullshit. That's not going to make ME happy.

Boy, It's Really Coming Down

Crowns are like splashes! I can't wait to make some splashes this summer. Making water crowns, as I like to call them, is one of my favorite things to do. I can't wait to do some pond diving, rope swinging, tree belly flopping this summer. Soon, soon, soon….

Yes, I'll Rescue You

Save us brave hero! Your physical strength, mental acuity, and steel resolve are needed to protect us lower life forms. Sacrifice yourself for us, brave one!

Please do not use your favorable genetic and social circumstances solely for your own benefit, because well… umm that'd be just… well… it wouldn't be what Jesus would do.

Now Make Him Cute

One thing that really peeves me when dealing with other humans is when they make excuses. They give themselves an often complex reason for not doing what they know is the right thing. They tell themselves a story where they cast themselves as the victim of these horrible outside forces just so they can maintain their image of themselves as an innocent in an evil world.

People like this are such weenies. I can't stomach having to endure listening to their stories. I can see through their veneer so easily. They aren't hiding their dark, slimy, moist underbellies, from me!

I do some rotten things sometimes, but at least I don't hide my belly. My belly has a suntan. I'm a lot of crummy things but I pride myself on not making excuses or hiding my intentions.

Let's not fool ourselves. Being a civilized human is difficult. On the one hand we have this biological imperative to individually survive, thrive, and reproduce and on the other we have to keep that urge in check sometimes to keep the peace with the other humans and living creatures that share the planet with us. It's a tough balance to pull off.

It's not all rainbows and sunshine so let's not pretend that it is. People who can't admit this fact to themselves and are constantly broadcasting a commercial of themselves as these innocent bystanders is hopelessly frustrating.

I don't know why I whine. It does no good. The defensive, the excuse makers, they're most people and most people are not really self aware. They're on social autopilot.

OK… deep breaths…

Yeah this all came from me doing a quick doodle of Tim Curry in his Satan makeup from promotional photos for the movie 'Legend' and putting a note to myself to make him cute.

It's my belief that everybody should be able to draw a cute devil. Cute devils are such great metaphors, because, like I was saying, most really evil behavior is wrapped in a candy coating.

Thanatos... Phobos... Deimos

Here's some quickie character designs. These are going to be costumes at some point... part of a ritual I'm designing. Thanatos is the Greek daemon of death... Phobos is panic... Deimos is fear. It's been useful personifying these ideas and making them interact. It's an effective way to understand your own feelings and where they come from. Plus when you make them cartoons you can almost mock these negative feelings, making it easier for you to get a handle on them so you can become more self aware and less likely to unknowingly become an emotional monster. That's the power of mythology folks.

Hey There, Blue Eye!

Here's what I paint when I watch Samurai Jack and listen to Magical Mystery Tour. I'm putting my new color skills to the test and just playing around in Photoshop ( finally got myself a license! )... nothing too serious... it is Saturday after all. Enjoy the eyeball candy.

The Three Muses

Muse ONE: Left. He's pointed. He's anger. He will lash out at the world and show the rest of the world that he is the superior animal specimen. This muse has his 'nose to the grindstone' but his higher mind is blank. He has no use to discover unuseful patterns. He is therefore single-minded, unwise, and necessarily stressed-out.

Muse TWO: Right. He sees wonder everywhere. He seeks external stimulation. He seeks acceptance by others. He has a difficult time establishing a self identity. He avoids commitment. He's constantly shifting. He is not a self starter. He is a passive observer of the Universe, too passive.

Muse THREE: Middle. He is mystery. He is the unknown. He is the spirit of self discovery. His presence is elusive. He is the most powerful muse. Following him will lead you down the path of righteousness but he is semi transparent and is often lost in confusion when environments become overwhelmingly complex and over populated.

Brave Warriors

Brave Warriors… Noble Savages… men who live as designed by evolution's slow plodd(tt)ing. They are at peace with their surroundings. They actually need one another, not in the modern abstract emotional way, the sort that somehow just breeds resentment, but need in the simplest sense, a helpful set of hands, eyes, and another mind to assist the tribe in navigating life's perils.

They grieve the dead but do not feel other kinds of loss. They do not fight their inner nature. They do not have to. They do not have philosophy. They do not need it.

It All Leads To Six

One… Two… Three.. Four… Five… Six. Yes, the number six. It's an unusual number, certainly.

You can't feel six. You have a natural sense for the other numbers. One… eh, you got a nose, maybe you have a penis, so you can feel one. Two… well every time you look in the mirror you're reminded of two. You have two eyes dontcha? You stand on two legs. Three… the nipples / belly-button combination gives you that. You can see them all every time you look down. And men have two testicles that accompany the penis so we have a special additional sense of three. Four… well you have four limbs sprouting from your torso. Five… the digits on each of your hands and feet, man! Those are essential. Six… hmmmm I can't work that one out. Nope, I just don't feel six.

Corbusier, Aerobic, Instructor, Radiation, Holocaust… well that's for you to workout…

Listen Up!

"I'm in emotional pain", he said. "My dreams continue to go unrealized!"

He continued, "I hold on to the childish belief that if I complain, whine, and pray that some higher power will give me everything that I want.

What do I want? I long for the love and admiration of people in better social standing than I so I can join their ranks. I never admit this to others or even to myself most days. Instead, I will say, 'I want fulfillment'. I will say 'I just want to be happy'.

Sadly, currently I do not have the ability or the fortunate circumstances to acquire this love and admiration I desire so badly. So I guess in the meantime I will settle for the company of lower but more available members of society, like this loser here with the big ears. He looks like a good listener. Yes, I will complain to him continuously that the world is making it impossible for me to realize my childhood dreams! I will feign interest when he recounts his struggles, nodding along with his remarks, smiling when he makes jokes, recalling details of his anecdotes to prove that I am attentively listening and sympathizing. But I am not! I'm too busy thinking about my own imaginary struggles and pain and I'm forever scheming ways to climb to the top of the pile.

Hey, I heard up there life is way better! You never have to worry… ABOUT ANYTHING! AND you can travel… ANYWHERE! AND the liquor actually tastes good and it doesn't give you hangovers! AND the girls' pussies taste like ambrosia, the fuckin' food of the god's man! Jesus Christ, why the fuck am I still here?!

Hmmmph rghhgh umm humph… yes. I will make him feel like we have a special bond and a mutual understanding that will last our lifetimes, but once I find people more useful in my climbing the social ladder I will drop him. The goodnatured dumbass won't even see it coming!

Why am I being so candid with you? Because you do not threaten me. You are not useful to me. You are a stranger. You are not a chess piece in my game"

Creamsicle Nebula

What happens when you add bass and a synth lead to a song I previously posted called Lucy In The Cage With Smallpox? You get this song, Creamsicle Nebula! Click this to download, friends!

Hmm... what's that? Ashamed of plagiarizing myself? No not at all. Wait... is that even possible? Hmmm that's something to noodle with my noodle about.

An Ode To The Sun

You make me feel warm.
You make me feel free.
You make me synthesize Vitamin D.

Backalley Altair 6

A new Galactic Ashleys' song click here to download!. This one's called Backalley Altair 6. Yeah that's a Star Trek reference. No, I'm not ashamed of that. I'm still working on the garage rock / outer space aesthetic. The original Star Trek series has been useful source material. Thanks go out to Ben and Abe for their help with this one too. This started out as a song Abe and I smooshed together called Steak Mt. Fuji but I simplified it and made it simpler for popular consumption. Ben played some guitar on this and helped me cook up some of the arrangements.

Hey! And there's a lot of other MP3s up on this site if you like this one. Don't believe me? Click this and see for yourself!

Where Are You Going Sailor?

When you fight another person you're really just fighting yourself. Yeah we're all connected remember? Buddhism 101, fool. We're all bloodshot-eyed blobby helpless things.

We're just grains of sand on the vast beach of space-time. Don't get caught up worrying about your ego and fighting others because you'll lose track of the wonder all around you. Get a clue, Jack!

Feed Me Grapes

Enjoy the easy living while you can. Pretty soon your time will be up and society will be expecting its comeuppance. You can't live high on the hog forever. That hog will buck you off and pretty soon you'll be wallowing in mud and shit once again. And, hey, when the time comes for you to fall don't try to take the rest of us with you. Be a man; don't pull a Wallstreet here.

Let's BBQ

It's warming up. Pretty soon the smell of barbecue will be wafting through the air. Gather your friends for a barbecue of your own. Eating food cooked on an open flame outdoors is one of life's few perpetual pleasures. It will never get old. It's in our DNA.

GCTATTCTACTACTACCTAGGGCCATACTCATACTCT: translation, 'MAN LIKE BBQ'

Symbol Of Power

Can't you feel the power radiating from this post. Doesn't it unsettle you? Feel that tingle in your toes? That's the energy inside you being excited by this symbol. Where did this symbol come from? I can't say I drew it because I think it was divinely inspired. It flowed out of me like milk into a bowl. I can't take credit for it. Some cosmic force guided me in its creation. Put it on a t-shirt I dare you.

Caricatures

I've been thinking about making some quick scratch on the side doing caricatures this summer. Here's some quickie self caricatures I made with a chisel tip sharpie. These come pretty quick. I can do one of these sharpie caricatures in two or three minutes.

The cliche, 'beauty is in the eye of the beholder', becomes very clear when you scrutinize your face in this way. I thought a couple of times, "Christ! How did I ever convince so many girls to kiss me? I'm hideous!" and then there were other times when I was thinking, "Damn… you're a handsome man!"

You figure out your most distinguishing features pretty quickly. For me it's my oversized wrinkly forehead, crooked nose, unibrow, groomed but somehow still scruffy hair and beard, and my long girly eyelashes. It's funny how the human brain can reduce something so complex as a human face to just a few signature details. Enjoy Cliff's Notes me, everybody.






Here's a couple of quickies of my friends too. Just wanted to get a quick likeness. I worked these at top speed.

Inside Outside The Lower Half

Jesus! Don't go outside and under the upper mid block! If you do you'll slip into the outer lower greater half switch back!

It's better to go through the new greater western metro expressway. It'll get you going to where you need to be much faster. You see that, right? You can see that? Yes, that's the right decision.

Bow Tie Daddy

Don't go blowing your dome. Everything is under control. Iowa is growing beans and corn. We got that oil in Alaska. And we have the biggest bombs in the world! The latest Netflix came in. Watch a movie and cool out.

Girls On Your Brain

Girls on your brain
Wrench in your hand
Skull mountain has blown its top
and made silicon from sand

Tonight will become tomorrow
Embers will become ash will become air
And no one will notice
Until it dyes our hair

Slim Whitman

...the man who made yodeling romantic. I love this guy's music.

Universe University

Blowhard: I won't go to Yale. I'm going to the school of hard knocks. The school of LIFE, Universe University.

Concerned Friend: You know the problem with going to Universe University is you don't get credit. No diploma is handed out at the graduation ceremony. In fact there is no graduation ceremony!

Blowhard: blah blah blah... all pomp and circumstance... blah blah blah... horse and pony show... blah blah blah... I'm going anyway.

Concerned Friend: You're going to attend anyway? You know you won't be able to set up a practice without accreditation. You have to go underground and work outside the establishment.

Blowhard: blah blah blah... nothing is real anymore... blah blah blah... life is all abstract... blah blah blah... I don't need a piece of paper... blah blah blah... I don't care.

Concerned Friend: You don't care? Well good luck, my friend. Be bold in your venture. Time will prove you were right long after you're dead; if that's any consolation

Pig Sympathy

'There there, good buddy. It'll be okay. At least you aren't forced to sit in pens all day and fed slop all your life. Well... actually...

Hey at least you have all your hooves!'

Whale Genie

I just finished reading Moby Dick. It was a good book but it was hard to read through. Melville has some absolutely brilliant insights and he's fantastic at creating metaphors. Every object discussed in the book has some symbolic meaning that he spends pages explaining to you but he actually sucks at writing a coherent narrative. The story itself has a strange flow and will be interrupted at odd points for chapters like the one where the narrator, Ishmael, will describe the inadequacy of the whale illustrations he's seen or some other minor aside. These chapters bog down the more interesting portions of the book.

But to be fair the main story, Ahab chasing the white whale, Moby Dick, to get revenge for the whale taking his leg, is secondary to Melville as Ishmael theorizing about nearly all aspects of western civilization and using everything on a whaling ship and in the ocean as metaphors to solidify his theories. Ayn Rand pulls this same trick, philosophy masquerading as a novel. Ayn Rand is much more narrow minded though; Melville's philosophy is much more nuanced and deeper.

Both writers are attempting the same thing, to create a mythology that explains American values, but the difference is Rand is a true believer in those values and Melville is weary of them and can see the harmful side effects they cause.

Anyway Moby Dick is great mythology, but still it comes off as cobbled together. One thing that bothered me was Ishmael basically disappears two-thirds of the way through and is replaced by a generic third person narrator. Melville realized this himself and included an epilogue where Ishmael explains he fell off a whaling boat and was able to view all the action from his position floating in the sea as if he was omniscient. It was a cheap literary bandaid to explain the narration shift.

But still that's forgivable when you have passages like this one. In this one Ishmael is squeezing chunks of spermaceti, which is sperm whale oil.

Squeeze! squeeze! squeeze! all the morning long; I squeezed that sperm till I myself almost melted into it; I squeezed that sperm till a strange sort of insanity came over me; and I found myself unwittingly squeezing my co-laborers' hands in it, mistaking their hands for the gentle globules. Such and abounding affectionate, friendly, loving feeling did this avocation beget; that at last I was continually squeezing their hands, and looking up into their eyes sentimentally; as much as to say, Oh! my dear fellow beings, why should we longer cherish any social acerbities, or know the slightest ill-humor or envy! Come; let us squeeze hands all round; nay, let us all squeeze ourselves into each other; let us squeeze ourselves universally into the very milk and sperm of kindness.

There's this freedom in performing repetitive sensual labor. It's meditative. I think it's the reason why some men like mowing their lawns. Most Americans will scoff at the idea of sitting in the lotus position with their eyes closed for twenty minutes to obtain peace of mind; instead they'll breakout their gas powered lawn mowers and push it in straight lines for an hour or two. Here's how it continues.

Would that I could keep squeezing that sperm for ever! For now, sincy by many prolonged, repeated experiences, I have perceived that in all cases man must eventually lower, or at least shift, his conceit of attainable felicity; not placing it anywhere in the intellect or the fancy; but in the wife, the heart, the bed, the table, the saddle, the fire-side, the country; now that I have perceived all this, I am ready to squeeze case eternally. In thoughts of the visions of the night, I saw long rows of angels in paradise, each with his hands in a jar of spermaceti

Melville's right. We have simple drives but in today's world they manifest themselves in bizarre and complex ways. The wisest of us recognize this and satisfy these drives in simple ways. The unwise have affairs with transexuals, buy private jets, and start wars to get their jollies! What a fantastically efficient way to make these points too.

In summation... it's a worthwhile read. It'll take some perseverance though. It won't be all sunshine and lollipops.

Hank Williams

Who knew this is what he was planning all along?

Conway Twitty

I picked up a book of photos of old country singers from the library. I found country singers active during the years leading up to and including the 1970s to have some of the best faces. This is Conway Twitty. Expect more of these.

Potassium Sulfide

When I saved this doodle after scanning it I called it Potassium Sulfide. I don't know why that popped into my head. But to give you something to latch on to on a rather weird abstract post here's a neat little factoid about potassium sulfide I pulled from Wikipedia.

-- Use in fireworks --
Potassium sulfides are formed when black powder is burned and are important intermediates in many pyrotechnic effects, such as senko hanabi and some glitter formulations.

"Senko Hanabi and the Glitter Formulations" would be a great band name. Especially if your singer was Japanese.

And that's all. Have a great day, friends!

Ghosts In The Room

In case you were wondering...
Why do ghosts make a room cold?

I think my kitchenette is haunted by the ghost of Cap'n Crunch. It's always so cold in there.

Easter Nightmare

My family didn't have Easter dinner at home. We went to a restaurant called 'The Venus de Milo' for their Easter buffet. This place is one of those reception hall slash faux classy restaurants which is normally booked for large wedding receptions, post funeral receptions, and other social events by people with questionable taste. My senior prom was held there in fact.

I hate celebrating holidays in public places. My family normally has holiday dinners together at my parent's apartment or one of my older siblings places, but because of some extenuating circumstances, the mom and older sister cabal which decides where holiday meals will take place, opted to eat at a restaurant. I'm the youngest son in the family so I don't really have much of a say in the decision. Also I'm not a good cook and probably couldn't pull off a big family meal. It's really one of those 'put up or shut up' situations. I opt to shut up most of the time.

But that doesn't mean I won't bitch! I felt like something was broken with the place and that I was surrounded by broken people. Going to restaurants on the holidays is sad. I can't tell you why exactly but it is.

Let me just say it wasn't all bad. On the plus side I got to see my older sisters together and playing with my nieces and nephews is always a blast, they're all cool and really bright kids. Which we could have done together at one of our homes.

The waitstaff looked miserable. I felt guilty being there, like I was contributing to these poor people's miserable day. I was keeping them from their own family gatherings simply because we apparently needed someone to pick up our buffet plates and bring us tiny glasses of soda from the bar. I hope they got paid time and a half at least.

I really didn't want to be there at some points. I escaped to the bathroom for a breather about halfway through. I took a halfhearted piss though I didn't really need to. I had no choice but to be there I suppose. The alternative was to snub my family and I couldn't do that. But the place was just too big. The people too big.

I can't stand crowds. Especially crowds which consist mostly of obese old people with walkers, canes, crutches, and motorized scooters, greaseball men with paisley polo shirts with popped collars, and bitchy middle aged women who dress in slutty clubbing gear with their flower and crucifix ankle tattoos fully visible yelling at their fat children to put their cell phones and Nintendo DSs away. Oh man, it was grim!

This is all slightly annoying, right? This is the day to day stuff you have to endure in working and lower middle class America. You may be thinking that I'm just being a miserable shit just to be a miserable shit because I must enjoy it. Well yeah that's partially true but I didn't get to the worst part… this little detail will convince you I'm not being melodramatic.

Sigh… by far the worst part was the guy dressed up in a bunny suit who was shuffling around the tables waving to either really excited or frightened children and getting his photo taken by dozens of cellphone cameras. Parents would force the guy to hold their toddlers and then direct him with their hands to reposition himself so they can get the perfect shot. His giant bunny head had a plastic face with a wall-eyed expression and I could see the artificial fur on his thighs and inner elbows was all matted from having kids crawling all over him. I hope the guy got paid well, because it looked like absolute torture.

So my doodle today is dedicated to you bunny man. May you one day rise above!

Crib Life

This is a Modern American. Yep, America, collectively, is still a cultural toddler. Western Europe is drinking wine from crystal stemware and we still sip Cherry Kool-Aid out of a sippy cup.

It's because we are the offspring of selfish pricks. Despite what we'd like to think our ancestors weren't all escaping persecution, they weren't all heroic dissenters, they weren't all fleeing corrupt regimes and boldly making a new life for themselves in untouched wilderness. Most of them probably looked around their totally adequate hometown and said, 'This isn't good enough for me! Special me. Unique snowflake me!' We are the black sheep of the human family. Not the good kind of black sheep either but more of the completely selfish -- only see him on holidays -- over forty but can still party like a rock star -- alcoholic -- uncle black sheep.

We throw back our piss yellow, headache inducing beer, and eat our cattle ground up and by the pound. And we do this all with the utmost pride. We don't know any better. We still haven't learned what quality is. Our mother and father lands can have dinner at home, share a bottle of wine, and read Proust in winged backed chairs, while we get stoned, drink a handle of Jack, and watch Final Destination 2 in Seth's basement.

Yup, we are rebellious youth. Yeah this was all okay when we had all that wilderness to work with. We can thank the natives for keeping it so well preserved for us. Those wise Indians kept their population in check, and they didn't have the need to level or piss on every last inch of land they saw. So we had a lot to work with when we snatched it from them. We had hope and the possibility that we could all get a hearty slice of life pie. If anyone thought society was corrupt they and some friends could just move west and build a better one.

We had all that unsettled land crawling with animals and all kinds of useful money making stuff just waiting to get yanked out of the ground! Get the deed to the right stretch of land and you could become the most powerful man in the world. And if you played your cards right you could secure a life of leisure for your branch of the family tree. Your DNA could live-on forever sitting poolside!

But sadly manifest destiny became manifest reality. We settled this place shore to shore. The West died. Hope died. And then to make matters worse everyone had to go and make more of themselves. So now there's too many of us with asshole DNA crawling all over this country and they're all playing 'King Of The Mountain', and it's so crowded on the mountain that no one can't get off! We're all forced to play.

We will all have to play this game because the majority of us won't settle for second. We'll hold on to ideals that can't possibly be realized. We tell ourselves that there's room on the winners podium for everyone but we know there isn't. We'll gamble our livelihoods in hopes that we are the one in a million exception. We're all dreamers and nobody likes having their dreams dashed by cynical underachievers, the losers!

Yeah that's right they're losers. Just because they've abandoned their dreams and settled for a mediocre existence doesn't mean the rest of us should. We aren't failures like the rest of the nations on this planet. Fuck it! We don't care if we turn all the arable land left into desert. Fuck it! We'll continue to eat cheap fat and sugar packaged a thousand different ways and sit in our 'living' and 'family' rooms, watching our home theatre systems. And as we sink deeper and deeper into our overstuffed couch cushions we'll sink this country deeper and deeper into the ocean with our total combined biomass.

It's true. The teutonic plates supporting us will give way. The earth's crust will crack. A fissure will start in Atlanta. Why Atlanta? I don't know I just think of it as America's fattest metropolis. But anyway the earth's crust will crack there and the entire South East will fall into the Earth's mantle and Ted Turner will be devoured by lava. And then it will spread outwards. No American city will be safe. Princeton, New Jersey… Cambridge, Massachusetts… New Haven, Connecticut… Palo Alto, California... all those places populated by skinny intellectuals who buy their food at farmer's markets, go to rock climbing gyms, who knew what hommus was ten years ago, and send their kids to Montessori schools will get swallowed up too. Nobody will escape.

North America will commit suicide. It won't be able to go on living with the shame of having been raped by generation after generation after generation of selfish myopic American slobs. It will have abandoned hope. It will grow depressed watching the power hungry fight each other for the glory of selling the American people more comfortable and entertaining ways to slowly kill themselves.

Eh… I'm so negative. This is all very negative. But look at our ambitious, go-getter citizens these days compared to the past. Andrew Carnegie at least made himself obscenely wealthy in a semi dignified way. Well maybe… I wasn't really there… Well he was an orphan, so I'll cut him some slack.

Well in any case our orphans don't become industrial magnates anymore. Hell, no one does! Instead everyone is crying for the attention of the media long enough so some of that preexisting paper wealth gets shuffled their way. We all want to be rewarded just for having an interesting personality or at least thinking we do.

Oooh… I feel as if I have just insulted myself. What am I doing? I think I'm so interesting. I think I'm so talented. I think I'm better than everyone else I meet. But what do I really have? Nothing… just a sense of intellectual superiority.

Well, shit, my parents are working class. I grew up in and for some strange reason moved back to a city in decline. Fall River, Massachusetts is a city with virtually no hope. Twice the state average of unemployed, murder rate climbing, and infrastructure crumbling. This is my home. My family doesn't own anything. I have no real money. I have no real power. I can't coerce anyone to do anything for me. All I can do is plead with the powerful that I'm smart enough and useful enough to them to let me join their golden tit.

I'm no different than the people I'm knocking! I want to be discovered, commissioned, paid… yeah paid! Paid for doing what comes naturally, for doing this… for simultaneously probing my brain and convincing the world that life in America is getting worse and it will continue to get worse if we don't start making changes. It's noisy and boring and overcrowded and simultaneously lonely. And it's this way because we expect too much, because we deceive each other to get what we want, and we're so individualistic and myopic that we can't see that treating life like a race is pointless. We're just racing to the grave.

How'd I slip into self pity? What was I talking about? Andrew Carnegie? Yeah, that's it! Well there will be no more new Carnegies, Vanderbilts, or Rockefellers and pretty soon we'll exhaust our supply of Gatess, Jobss, and Ellisonss. Pretty soon the only way you'll be wealthy enough to retire from the cancer of American society permanently while still having a sexy wife and becoming patriarch of a quality family unit is to be a media celebrity and hype yourself while other people watch.

You want to make a couple dozen million in the future to secure a townhouse in the Village and the cottage upstate? ( These are, of course, the required buildings to optimally house and nourish your future family's bodies and minds. ) Well if you want those things you'll have to be a Jay-Z or a P. Diddy. You can't go the quiet dignified industrial route anymore. You'll have to be an entertainer and shameless self-promoter. You'll have to play the media and sell people merchandise with your picture on it. Just get in the public eye long enough to sell them some garbage fad and then get the hell out of there. Then with the money you make buy up some real estate, up the rent, and then you're sitting pretty. You can ride out your life in luxurious-leisurely-luxury, because you'll have captured the nation's eyeballs long enough to get the right pieces of paper.

And finally… rant rant rant rant! Wow! I'm done. And all that inspired by a silly cartoon of a thuggish baby with tattoos. Caffeine is a powerful drug!

Enjoy the rest of your Tuesday, beloved reader, you sweet exception you!

The Devil Is Coming To Town

Uh oh here he comes. Apparently the citizens in your town couldn't keep it in their pants. You made too many of yourselves. Now you're a viable market! You brought this on yourselves!

Your sleepy town, with its bakeries, fish markets, and produce carts, will soon be replaced with fluorescent warehouses and parking lots.

He will give you a 10% employee discount. He will give you convenience. He will make you wear an embroidered polo shirt and khakis. He will give you wall-to-wall carpeting and central air conditioning. You will give him your health. You will give him your self-respect. He will make your town safe, comfortable, boring and miserable.

You can't resist. Join him or learn to enjoy destitution and isolation.

At The Movies

Movies are so powerful it's scary. It's because stories are powerful.

We need stories. They provide tools for making sense of our experiences. They give us a way to organize our memories to better prepare for future situations which remind us of stories in our past.

Movies are a unique story telling medium. With other forms you bring a lot to the table. It's a conversation you have with the story. Your experiences fill in the gaps. You have a say in how it's imagined. A lot of your memories help construct the story, better realize it, make it whole.

But movies do most of the work for you. In the right hands they can communicate a point of view or a very subtle experience with the most clarity, but in the wrong hands they can make you believe and feel impossible things.

It makes perfect sense that the movie industry is so big in the USA. We're a nation of people who believe impossible things and want so desperately to feel impossible things as well. A nation of dreamers who day by day loosen our tether to a shared earthy reality.

Basically, we all want to live without pain in heaven where we'll all look and feel amazing. Ahhhh, someday....

Oberon and the Paisley Monster - Fireside Friends

Here's a quick doodle I made at the Process Initiative weekly meetup. I liked the way this one came out. The man in the foreground is Oberon. His forehead isn't that big. The paisley looked like tentacles to me so I made him more cephalopod than he is in real life. In reality he has the forehead and jaw of a viking!



This one is a quickie of Chris and Andre(?). I think that was his name. Both are enjoying the sweet Providence air and a bonfire celebrating all that is good and holy in the human experience.

Spring Love

Man! I'm hankering for a good old spring-fling -- couple of month -- emotionally heavy -- heartbreaking -- heterosexual -- commitment-phobic -- American -- working class -- service job -- self loathing -- love fest! Ain't nothing finer in this whole world!

They're so pure! So... just... right, dammit! This weather puts me in the mood for love!

Path Of Least Resistence

You follow the path of least resistance and avoid confrontation you can have a comfortable life here in America. You can lounge in a lazy boy and wear merchandise made by cigarette companies for next to nothing. All you have to do is sacrifice your dignity, and let the big wheelers and dealers let their metaphorical lap dogs poop all over your metaphorical lawn.

But you gotta stand up for yourself otherwise you're cannon fodder, a pawn in someone else's power game. Be tough, be bold, be willing to take a few punches. That's the only way to really live.

This Man, This Monster, These Hands!

Sigmund Freud said, 'Anatomy is destiny'. Look at your hands. Do you have big bear paws or delicate, glassy, boney hands? Do you put your mitts into boxing gloves, dishwater, clay, or somebody else's insides?

I have small almost feminine hands but with a ton of hair on my knuckles. Jesus, what does that say about me?! How can I be an astronaut with hands like that?!